Hyperhomocysteinaemia Promotes Doxorubicin-Induced Cardiotoxicity in Mice
Abstract
:1. Introduction
2. Results
2.1. Methionine-Induced Hyperhomocysteinaemia Exacerbates Doxorubicin-Induced Cardiac Dysfunction
2.2. Methionine-Induced Hyperhomocysteinaemia Exacerbates Doxorubicin-Induced Cardiomyopathy
2.3. Folic Acid Supplementation Inhibits Methionine-Induced Hyperhomocysteinaemia and Its-Associated Cardiac Dysfunction
2.4. Folic Acid Supplementation Reduces Hyperhomocysteinaemia-Aggravated Cardiomyopathy
2.5. Increased Oxidative Stress Might Contribute to Hyperhomocysteinaemia-Aggravated Cardiomyopathy
3. Discussion
4. Materials and Methods
4.1. Animals, Diets and Experimental Design
4.2. Serum Biochemical Assay
4.3. Echocardiography
4.4. Histopathology
4.5. Quantitative Real-Time PCR Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Arcamone, F.; Cassinelli, G.; Fantini, G.; Grein, A.; Orezzi, P.; Pol, C.; Spalla, C. Adriamycin, 14-hydroxydaunomycin, a new antitumor antibiotic from S. peucetius var. caesius. Biotechnol. Bioeng. 1969, 11, 1101–1110. [Google Scholar] [CrossRef]
- Bonadonna, G.; Monfardini, S.; De Lena, M.; Fossati-Bellani, F. Clinical evaluation of adriamycin, a new antitumour antibiotic. Br. Med. J. 1969, 3, 503–506. [Google Scholar] [CrossRef]
- Bonadonna, G.; Monfardini, S.; De Lena, M.; Fossati-Bellani, F.; Beretta, G. Phase I and preliminary phase II evaluation of adriamycin (NSC 123127). Cancer Res. 1970, 30, 2572–2582. [Google Scholar]
- van der Zanden, S.Y.; Qiao, X.; Neefjes, J. New insights into the activities and toxicities of the old anticancer drug doxorubicin. FEBS J. 2021, 288, 6095–6111. [Google Scholar] [CrossRef]
- Octavia, Y.; Tocchetti, C.G.; Gabrielson, K.L.; Janssens, S.; Crijns, H.J.; Moens, A.L. Doxorubicin-induced cardiomyopathy: From molecular mechanisms to therapeutic strategies. J. Mol. Cell. Cardiol. 2012, 52, 1213–1225. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, F.S.; Burgeiro, A.; Garcia, R.; Moreno, A.J.; Carvalho, R.A.; Oliveira, P.J. Doxorubicin-induced cardiotoxicity: From bioenergetic failure and cell death to cardiomyopathy. Med. Res. Rev. 2014, 34, 106–135. [Google Scholar] [CrossRef] [PubMed]
- Rawat, P.S.; Jaiswal, A.; Khurana, A.; Bhatti, J.S.; Navik, U. Doxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective management. Biomed. Pharmacother. 2021, 139, 111708. [Google Scholar] [CrossRef]
- Zamorano, J.L.; Lancellotti, P.; Rodriguez Munoz, D.; Aboyans, V.; Asteggiano, R.; Galderisi, M.; Habib, G.; Lenihan, D.J.; Lip, G.Y.; Lyon, A.R.; et al. 2016 ESC Position Paper on cancer treatments and cardiovascular toxicity developed under the auspices of the ESC Committee for Practice Guidelines: The Task Force for cancer treatments and cardiovascular toxicity of the European Society of Cardiology (ESC). Eur. J. Heart Fail. 2017, 19, 9–42. [Google Scholar] [CrossRef]
- Armenian, S.H.; Lacchetti, C.; Barac, A.; Carver, J.; Constine, L.S.; Denduluri, N.; Dent, S.; Douglas, P.S.; Durand, J.B.; Ewer, M.; et al. Prevention and Monitoring of Cardiac Dysfunction in Survivors of Adult Cancers: American Society of Clinical Oncology Clinical Practice Guideline. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 2017, 35, 893–911. [Google Scholar] [CrossRef]
- Kumar, A.; Palfrey, H.A.; Pathak, R.; Kadowitz, P.J.; Gettys, T.W.; Murthy, S.N. The metabolism and significance of homocysteine in nutrition and health. Nutr. Metab. 2017, 14, 78. [Google Scholar] [CrossRef] [PubMed]
- Zaric, B.L.; Obradovic, M.; Bajic, V.; Haidara, M.A.; Jovanovic, M.; Isenovic, E.R. Homocysteine and Hyperhomocysteinaemia. Curr. Med. Chem. 2019, 26, 2948–2961. [Google Scholar] [CrossRef]
- Kaye, A.D.; Jeha, G.M.; Pham, A.D.; Fuller, M.C.; Lerner, Z.I.; Sibley, G.T.; Cornett, E.M.; Urits, I.; Viswanath, O.; Kevil, C.G. Folic Acid Supplementation in Patients with Elevated Homocysteine Levels. Adv. Ther. 2020, 37, 4149–4164. [Google Scholar] [CrossRef]
- Clarke, R.; Daly, L.; Robinson, K.; Naughten, E.; Cahalane, S.; Fowler, B.; Graham, I. Hyperhomocysteinemia: An independent risk factor for vascular disease. N. Engl. J. Med. 1991, 324, 1149–1155. [Google Scholar] [CrossRef]
- Fu, Y.; Wang, X.; Kong, W. Hyperhomocysteinaemia and vascular injury: Advances in mechanisms and drug targets. Br. J. Pharmacol. 2018, 175, 1173–1189. [Google Scholar] [CrossRef] [PubMed]
- Podyacheva, E.Y.; Kushnareva, E.A.; Karpov, A.A.; Toropova, Y.G. Analysis of Models of Doxorubicin-Induced Cardiomyopathy in Rats and Mice. A Modern View from the Perspective of the Pathophysiologist and the Clinician. Front. Pharmacol. 2021, 12, 670479. [Google Scholar] [CrossRef] [PubMed]
- Songbo, M.; Lang, H.; Xinyong, C.; Bin, X.; Ping, Z.; Liang, S. Oxidative stress injury in doxorubicin-induced cardiotoxicity. Toxicol. Lett. 2019, 307, 41–48. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Luo, Y.; Qiao, Y.; Zhang, Z.; Yin, D.; Yao, J.; You, J.; He, M. Curcumin attenuates doxorubicin-induced cardiotoxicity via suppressing oxidative stress and preventing mitochondrial dysfunction mediated by 14-3-3gamma. Food Funct. 2018, 9, 4404–4418. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Li, H.; Qiao, Y.; Zhou, Q.; Chen, S.; Yin, D.; He, H.; He, M. Tetramethylpyrazine Attenuates the Endotheliotoxicity and the Mitochondrial Dysfunction by Doxorubicin via 14-3-3gamma/Bcl-2. Oxid. Med. Cell. Longev. 2019, 2019, 5820415. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Zhang, Y.L.; Zhang, L.; Zou, L.X.; Chen, C.; Liu, Y.; Xia, Y.L.; Li, H.H. Gallic Acid Suppresses Cardiac Hypertrophic Remodeling and Heart Failure. Mol. Nutr. Food Res. 2019, 63, e1800807. [Google Scholar] [CrossRef]
- Bai, J.; Yin, L.; Yu, W.J.; Zhang, Y.L.; Lin, Q.Y.; Li, H.H. Angiotensin II Induces Cardiac Edema and Hypertrophic Remodeling through Lymphatic-Dependent Mechanisms. Oxid. Med. Cell. Longev. 2022, 2022, 5044046. [Google Scholar] [CrossRef]
- Stone, K.P.; Wanders, D.; Orgeron, M.; Cortez, C.C.; Gettys, T.W. Mechanisms of increased in vivo insulin sensitivity by dietary methionine restriction in mice. Diabetes 2014, 63, 3721–3733. [Google Scholar] [CrossRef]
- Chin, K.; Toue, S.; Kawamata, Y.; Watanabe, A.; Miwa, T.; Smriga, M.; Sakai, R. A 4-week toxicity study of methionine in male rats. Int. J. Toxicol. 2015, 34, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Navik, U.; Sheth, V.G.; Kabeer, S.W.; Tikoo, K. Dietary Supplementation of Methyl Donor l-Methionine Alters Epigenetic Modification in Type 2 Diabetes. Mol. Nutr. Food Res. 2019, 63, e1801401. [Google Scholar] [CrossRef] [PubMed]
- Navik, U.; Sheth, V.G.; Khurana, A.; Jawalekar, S.S.; Allawadhi, P.; Gaddam, R.R.; Bhatti, J.S.; Tikoo, K. Methionine as a double-edged sword in health and disease: Current perspective and future challenges. Ageing Res. Rev. 2021, 72, 101500. [Google Scholar] [CrossRef]
- Navik, U.; Sheth, V.G.; Sharma, N.; Tikoo, K. L-Methionine supplementation attenuates high-fat fructose diet-induced non-alcoholic steatohepatitis by modulating lipid metabolism, fibrosis, and inflammation in rats. Food Funct. 2022, 13, 4941–4953. [Google Scholar] [CrossRef]
- Navik, U.; Rawat, K.; Tikoo, K. L-Methionine prevents beta-cell damage by modulating the expression of Arx, MafA and regulation of FOXO1 in type 1 diabetic rats. Acta Histochem. 2022, 124, 151820. [Google Scholar] [CrossRef]
- Joubert, M.; Jagu, B.; Montaigne, D.; Marechal, X.; Tesse, A.; Ayer, A.; Dollet, L.; Le May, C.; Toumaniantz, G.; Manrique, A.; et al. The Sodium-Glucose Cotransporter 2 Inhibitor Dapagliflozin Prevents Cardiomyopathy in a Diabetic Lipodystrophic Mouse Model. Diabetes 2017, 66, 1030–1040. [Google Scholar] [CrossRef]
- Zhang, D.; Chen, Y.; Xie, X.; Liu, J.; Wang, Q.; Kong, W.; Zhu, Y. Homocysteine activates vascular smooth muscle cells by DNA demethylation of platelet-derived growth factor in endothelial cells. J. Mol. Cell. Cardiol. 2012, 53, 487–496. [Google Scholar] [CrossRef]
- Deng, Y.; Li, Z.; An, X.; Fan, R.; Wang, Y.; Li, J.; Yang, X.; Liao, J.; Xia, Y. Hyperhomocysteinemia Promotes Cardiac Hypertrophy in Hypertension. Oxid. Med. Cell. Longev. 2022, 2022, 1486157. [Google Scholar] [CrossRef]
- Wu, L.L.; Wu, J.T. Hyperhomocysteinemia is a risk factor for cancer and a new potential tumor marker. Clin. Chim. Acta 2002, 322, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Hasan, T.; Arora, R.; Bansal, A.K.; Bhattacharya, R.; Sharma, G.S.; Singh, L.R. Disturbed homocysteine metabolism is associated with cancer. Exp. Mol. Med. 2019, 51, 1–13. [Google Scholar] [CrossRef]
- Plazar, N.; Jurdana, M. Hyperhomocysteinemia and the role of B vitamins in cancer. Radiol. Oncol. 2010, 44, 79–85. [Google Scholar] [CrossRef]
- Curigliano, G.; Cardinale, D.; Dent, S.; Criscitiello, C.; Aseyev, O.; Lenihan, D.; Cipolla, C.M. Cardiotoxicity of anticancer treatments: Epidemiology, detection, and management. CA Cancer J. Clin. 2016, 66, 309–325. [Google Scholar] [CrossRef]
- Herrmann, J. Adverse cardiac effects of cancer therapies: Cardiotoxicity and arrhythmia. Nat. Rev. Cardiol. 2020, 17, 474–502. [Google Scholar] [CrossRef]
- Lucock, M. Folic acid: Nutritional biochemistry, molecular biology, and role in disease processes. Mol. Genet. Metab. 2000, 71, 121–138. [Google Scholar] [CrossRef] [PubMed]
- Sobczynska-Malefora, A.; Harrington, D.J. Laboratory assessment of folate (vitamin B(9)) status. J. Clin. Pathol. 2018, 71, 949–956. [Google Scholar] [CrossRef]
- Shulpekova, Y.; Nechaev, V.; Kardasheva, S.; Sedova, A.; Kurbatova, A.; Bueverova, E.; Kopylov, A.; Malsagova, K.; Dlamini, J.C.; Ivashkin, V. The Concept of Folic Acid in Health and Disease. Molecules 2021, 26, 3731. [Google Scholar] [CrossRef]
- Ehrlich, M. DNA methylation in cancer: Too much, but also too little. Oncogene 2002, 21, 5400–5413. [Google Scholar] [CrossRef]
- Zhang, D.; Wen, X.; Wu, W.; Guo, Y.; Cui, W. Elevated homocysteine level and folate deficiency associated with increased overall risk of carcinogenesis: Meta-analysis of 83 case-control studies involving 35,758 individuals. PLoS ONE 2015, 10, e0123423. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Luo, H.; Zhang, L.; Huang, Y.; Liu, B.; Ma, K.; Feng, J.; Xie, J.; Zheng, J.; Hu, J.; et al. Hyperhomocysteinemia exaggerates adventitial inflammation and angiotensin II-induced abdominal aortic aneurysm in mice. Circ. Res. 2012, 111, 1261–1273. [Google Scholar] [CrossRef] [PubMed]
- Sun, W.; Pang, Y.; Liu, Z.; Sun, L.; Liu, B.; Xu, M.; Dong, Y.; Feng, J.; Jiang, C.; Kong, W.; et al. Macrophage inflammasome mediates hyperhomocysteinemia-aggravated abdominal aortic aneurysm. J. Mol. Cell. Cardiol. 2015, 81, 96–106. [Google Scholar] [CrossRef]
- Yang, A.; Sun, Y.; Mao, C.; Yang, S.; Huang, M.; Deng, M.; Ding, N.; Yang, X.; Zhang, M.; Jin, S.; et al. Folate Protects Hepatocytes of Hyperhomocysteinemia Mice from Apoptosis via Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)-Activated Endoplasmic Reticulum Stress. J. Cell. Biochem. 2017, 118, 2921–2932. [Google Scholar] [CrossRef]
- Zoungas, S.; McGrath, B.P.; Branley, P.; Kerr, P.G.; Muske, C.; Wolfe, R.; Atkins, R.C.; Nicholls, K.; Fraenkel, M.; Hutchison, B.G.; et al. Cardiovascular morbidity and mortality in the Atherosclerosis and Folic Acid Supplementation Trial (ASFAST) in chronic renal failure: A multicenter, randomized, controlled trial. J. Am. Coll. Cardiol. 2006, 47, 1108–1116. [Google Scholar] [CrossRef]
- Mann, J.F.; Sheridan, P.; McQueen, M.J.; Held, C.; Arnold, J.M.; Fodor, G.; Yusuf, S.; Lonn, E.M.; HOPE-2 investigators. Homocysteine lowering with folic acid and B vitamins in people with chronic kidney disease--results of the renal Hope-2 study. Nephrol. Dial. Transplant. Off. Publ. Eur. Dial. Transpl. Assoc. Eur. Ren. Assoc. 2008, 23, 645–653. [Google Scholar] [CrossRef]
- Heinz, J.; Kropf, S.; Domrose, U.; Westphal, S.; Borucki, K.; Luley, C.; Neumann, K.H.; Dierkes, J. B vitamins and the risk of total mortality and cardiovascular disease in end-stage renal disease: Results of a randomized controlled trial. Circulation 2010, 121, 1432–1438. [Google Scholar] [CrossRef] [PubMed]
- Jardine, M.J.; Kang, A.; Zoungas, S.; Navaneethan, S.D.; Ninomiya, T.; Nigwekar, S.U.; Gallagher, M.P.; Cass, A.; Strippoli, G.; Perkovic, V. The effect of folic acid based homocysteine lowering on cardiovascular events in people with kidney disease: Systematic review and meta-analysis. BMJ 2012, 344, e3533. [Google Scholar] [CrossRef]
- Pan, Y.; Guo, L.L.; Cai, L.L.; Zhu, X.J.; Shu, J.L.; Liu, X.L.; Jin, H.M. Homocysteine-lowering therapy does not lead to reduction in cardiovascular outcomes in chronic kidney disease patients: A meta-analysis of randomised, controlled trials. Br. J. Nutr. 2012, 108, 400–407. [Google Scholar] [CrossRef]
- Octavia, Y.; Kararigas, G.; de Boer, M.; Chrifi, I.; Kietadisorn, R.; Swinnen, M.; Duimel, H.; Verheyen, F.K.; Brandt, M.M.; Fliegner, D.; et al. Folic acid reduces doxorubicin-induced cardiomyopathy by modulating endothelial nitric oxide synthase. J. Cell. Mol. Med. 2017, 21, 3277–3287. [Google Scholar] [CrossRef]
- Shi, S.; Chen, Y.; Luo, Z.; Nie, G.; Dai, Y. Role of oxidative stress and inflammation-related signaling pathways in doxorubicin-induced cardiomyopathy. Cell Commun. Signal. 2023, 21, 61. [Google Scholar] [CrossRef] [PubMed]
- Goffart, S.; von Kleist-Retzow, J.C.; Wiesner, R.J. Regulation of mitochondrial proliferation in the heart: Power-plant failure contributes to cardiac failure in hypertrophy. Cardiovasc. Res. 2004, 64, 198–207. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Chen, J.; Li, Y.S.; Feng, Y.B.; Gu, X.; Shi, C.Z. Folic acid reduces adhesion molecules VCAM-1 expession in aortic of rats with hyperhomocysteinemia. Int. J. Cardiol. 2006, 106, 285–288. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Chen, J.; Li, Y.S.; Feng, Y.B.; Zeng, Q.T. Folic acid reduces chemokine MCP-1 release and expression in rats with hyperhomocystinemia. Cardiovasc. Pathol. 2007, 16, 305–309. [Google Scholar] [CrossRef]
- Zhu, W.; Zhang, W.; Shou, W.; Field, L.J. P53 inhibition exacerbates late-stage anthracycline cardiotoxicity. Cardiovasc. Res. 2014, 103, 81–89. [Google Scholar] [CrossRef]
- Zhu, W.; Reuter, S.; Field, L.J. Targeted expression of cyclin D2 ameliorates late stage anthracycline cardiotoxicity. Cardiovasc. Res. 2019, 115, 960–965. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.; Guo, X.; Wang, M.; Dong, C.; Gao, M.; Wang, H.; Kayoumu, A.; Shen, Q.; Wang, Y.; Wang, F.; et al. Scavenger Receptor Class B Type 1 Deletion Led to Coronary Atherosclerosis and Ischemic Heart Disease in Low-density Lipoprotein Receptor Knockout Mice on Modified Western-type Diet. J. Atheroscler. Thromb. 2017, 24, 133–146. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.P.; Lai, S.; Lin, Q.Y.; Xie, X.; Liao, J.W.; Wang, H.X.; Tian, C.; Li, H.H. CDC20 regulates cardiac hypertrophy via targeting LC3-dependent autophagy. Theranostics 2018, 8, 5995–6007. [Google Scholar] [CrossRef]
- Liao, J.; An, X.; Yang, X.; Lin, Q.Y.; Liu, S.; Xie, Y.; Bai, J.; Xia, Y.L.; Li, H.H. Deficiency of LMP10 Attenuates Diet-Induced Atherosclerosis by Inhibiting Macrophage Polarization and Inflammation in Apolipoprotein E Deficient Mice. Front. Cell Dev. Biol. 2020, 8, 592048. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Anf | CACAGATCTGATGGATTTCAAGA | CCTCATCTTCTACCGGCATC |
Bnp | GAAGGTGCTGTCCCAGATGA | CCAGCAGCTGCATCTTGAAT |
Nox2 | ACCGGGTTTATGATATTCCACCT | GATTTCGACAGACTGGCAAGA |
Nox4 | CAGATGTTGGGGCTAGGATTG | GAGTGTTCGGCACATGGGTA |
β-actin | ACTGCCGCATCCTCTTCCT | TCAACGTCACACTTCATGATGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fan, R.; Wang, Y.; Zhang, J.; An, X.; Liu, S.; Bai, J.; Li, J.; Lin, Q.; Xie, Y.; Liao, J.; et al. Hyperhomocysteinaemia Promotes Doxorubicin-Induced Cardiotoxicity in Mice. Pharmaceuticals 2023, 16, 1212. https://doi.org/10.3390/ph16091212
Fan R, Wang Y, Zhang J, An X, Liu S, Bai J, Li J, Lin Q, Xie Y, Liao J, et al. Hyperhomocysteinaemia Promotes Doxorubicin-Induced Cardiotoxicity in Mice. Pharmaceuticals. 2023; 16(9):1212. https://doi.org/10.3390/ph16091212
Chicago/Turabian StyleFan, Rui, Yao Wang, Jinjin Zhang, Xiangbo An, Shuang Liu, Jie Bai, Jiatian Li, Qiuyue Lin, Yunpeng Xie, Jiawei Liao, and et al. 2023. "Hyperhomocysteinaemia Promotes Doxorubicin-Induced Cardiotoxicity in Mice" Pharmaceuticals 16, no. 9: 1212. https://doi.org/10.3390/ph16091212