The Effect of FATP1 on Adipocyte Differentiation in Qinchuan Beef Cattle

Simple Summary

Previous research found that FATP1 plays an important role in the regulation of fatty acid metabolism and lipid accumulation in pig and chicken, but its function has not been explored in bovine adipocyte yet. In this study, we investigated the effect of FATP1 expression on preadipocyte differentiation in Qinchuan cattle using overexpression and interference assays. Our results reveal that FATP1 overexpression promoted preadipocyte differentiation, lipid droplet formation, and the expression of LPL and PPARγ, while FATP1 interference had the opposite effects on adipocyte differentiation and fat deposition. Following FATP1 overexpression and FATP1 interference in adipocytes, RNA-seq analysis identified that SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD genes were differentially expressed. Pathway analysis revealed that the PPAR signaling pathway, AMPK signal pathway, and Insulin signaling pathway were enriched with differentially expressed genes. We propose that the FATP1 gene may affect the beef quality by involving adipocyte differentiation and lipid deposition, and may shed new light on the formation mechanisms of adipose tissues.

Abstract

FATP1 plays an important role in the regulation of fatty acid metabolism and lipid accumulation. In this study, we investigated the patterns of FATP1 expression in various tissues obtained from calf and adult Qinchuan cattle, and in differentiating adipocytes. Next, we investigated the effect of FATP1 expression on preadipocyte differentiation in Qinchuan cattle using overexpression and interference assays. We also identified the differentially expressed genes (DEGs) and pathways associated with FATP1 overexpression/interference. Our results reveal that FATP1 was broadly expressed in heart, kidney, muscle, small intestine, large intestine, and perirenal fat tissues. While FATP1 overexpression promoted preadipocyte differentiation, fat deposition, and the expression of several genes involved in fat metabolism, FATP1 interference had the opposite effects on adipocyte differentiation. Following FATP1 overexpression and FATP1 interference in adipocytes, RNA-seq analysis was performed to identify DEGs related to fat metabolism. The DEGs identified include SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD. Pathway analysis revealed that the DEGs were enriched in the PPAR signaling pathway, AMPK signal pathway, and Insulin signaling pathway. Our results provide an in-depth understanding of the function and regulation mechanism of FAPT1 in fat metabolism.

1. Introduction

Fatty acid transport proteins (FATPs) are evolutionarily conserved transmembrane proteins in the fatty acid transport family. FATPs facilitate long-chain fatty acids (LCFA) importing into the cell by translocation at the plasma membrane [1]. In mammals, six different isoforms of FATPs (FATP1–FATP6) showing tissue-specific expression patterns have been identified as playing crucial roles in fatty acid metabolism [2]. FATP1, also known as Solute Carrier Family 27 Member 1 (SLC27A1), was the first reported family member, and is highly expressed in muscle, fat, heart, and liver [3,4], which are all characterized by high fatty acid uptake and rapid fatty acid metabolism. FATP1 may promote LCFA circulation flux. In addition, FATP1 may influence fatty acid metabolism and lipid accumulation by coordinating fatty acid esterification and oxidation [2].

The function and mechanism of action of FATP1 in fatty acid metabolism have been extensively researched in yeast and other cells. In S. cerevisiae, knockout of FATP1 decreased the activities of long chain acyl CoA synthetases [5]. In yeast, overexpression of FATP1 promoted an 8.2-fold increase in the fatty acid transport rate [6]. In 293 cells, FATP1 exerted overall control of triglyceride biosynthesis, and overexpression of FATP1 enhanced fatty acid uptake and increased triglyceride content [7]. In 3T3-L1 adipocytes, knockdown of FATP1 decreased triglyceride accumulation and reduced droplet size [8].

The role of FATP1 in fat deposition and adipocyte differentiation in livestock has also been widely researched. A positive correlation between FATP1 and intramuscular fat deposition has been reported in pig [9]. Moreover, overexpression of FATP1 induced intramuscular preadipocyte proliferation and fat accumulation in pig [10]. FATP1 overexpression also significantly upregulated the expression levels of PPARγ, CEBPα, LPL, PLIN1, and FASN, and downregulated the expression of β-catenin. It was subsequently hypothesized that FATP1 might repress the Wnt,/β-catenin signaling pathway and stimulate adipogenesis in porcine intramuscular preadipocytes [10]. This hypothesis is supported by the results of RNA interference experiments in chicken. Thus, silencing of FATP1 inhibited chicken preadipocyte differentiation and decreased the expression levels of FAS, C/EBPα, and PPARγ in chicken preadipocytes [11]. FATP1 expression levels were also positively correlated with intramuscular fat content in Korean cattle [12]. However, the corresponding mechanism of action has not been further explored in cattle using loss-of-function or gain-of-function experiments.

The bovine FATP1 gene is located on Chromosome 7, and comprised of 14 exons and 13 introns extending over more than 40 kb of genomic DNA [13]. In the present study, we analyzed FATP1 expression patterns in the tissues and adipocytes of Qinchuan cattle. In addition, we explored the effects of FATP1 on preadipocyte differentiation using overexpression and interference assays. DEGs and related signal pathways were identified using RNA-sequencing and data analysis. Our findings help further understanding of the role of FATP1 in adipocyte differentiation and lipid metabolism in bovine.

2. Materials and Methods

2.1. Sample Collection

All animal procedures were approved by the Animal Care and Use Committee of Northwest A&F University (Yangling, China). Three adult male Qinchuan cattle and three newborn male calves were obtained from the National Beef Cattle Improvement Center Farm (Yangling, China). The cattle were humanely euthanized and the following tissues were harvested: heart, spleen, liver, lung, rumen, kidney, reticulum, omasum, small intestine, abomasum, fat, and longissimus dorsi muscle. The harvested samples were rinsed in 1 × PBS, transferred to sterile, DNase and RNase free tubes, snap-frozen in liquid nitrogen, and finally stored at −80 °C for further analysis.

2.2. Chemical Synthesis and Transfection of siRNA

Three complementary pairs of siRNA (siRNA1, siRNA2, siRNA3) oligos (designed to inhibit the expression of the bovine FATP1 gene) and control siRNA (siNC) oligos were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The specific siRNA sequences are shown in

Table 1. The sequences of siRNAs for interference of bovine FATP1.

siRNA Name	Sequence
siRNA1   siRNA2   siRNA3   siNC	5′-3′ CCAACGCUGUGGCCAACUUTT 5′-3′ AAGUUGGCCACAGCGUUGGTT 5′-3′ GCAUGGAUGAUCGACUCUUTT 5′-3′ AAGAGUCGAUCAUCCAUGCTT 5′-3′ GCGUGGGUCAGUGUCUCAUT 5′-3′ AUGAGACACUGAACGCCCCTT 5′-3′ ACGUUUCUCCGAGCACGUTT 5′-3′ CGUUACGUGACACGGAGAATT

.

2.3. Construction of FATP1 Overexpression Adenovirus Vector

The CDS for bovine FATP1 was first cloned into a T vector. After digestion with NheI and HindIII, a fragment encoding the FATP1 CDS was then cloned into a pAd-Track shuttle vector. The shuttle vector encoding the FATP1 CDS was subsequently digested with Pme1 enzyme (NEB, Ipswich, MA, USA) to facilitate recombination with the pAdEasy-1 vector. After confirmation of recombination, the recombinant vector was digested with PacI. The linearized vector was then purified, packaged into adenovirus (designed as Ad-FATP1,/Ad-NC), and transfected into HEK 293A cells.

2.4. Bovine Preadipocyte Isolation and Culture

Preadipocytes were isolated from newborn Qinchuan calves as follows. Under sterile conditions, perirenal adipose tissues were collected and washed three times using 1 × PBS containing 1% penicillin/streptomycin. The adipose tissue samples were then sheared into pieces, and two volumes of 1 mg/mL collagenase type I was added (Sigma, Shanghai, China). The samples were then digested with constant shaking at 37 °C for 90 min. After digestion, the mixture was filtered, and cell lysate was added to the filtrate. After centrifugation, the cells were seeded into cell culture dishes containing DMEM/F12 (Gibco, Waltham, MA USA) with 10% FBS (Invitrogen, San Diego, GA, USA) and antibiotics. The cells were then incubated at 37 °C in a cell culture incubator using 5% CO₂.

2.5. Preadipocyte Differentiation, Transfection and Infection

Preadipocyte differentiation was induced using induction medium containing DMEM/F12, 10% FBS, 1% antibiotics, 5 μg/mL insulin (Sigma, St. Louis, MO, USA), 1 μm DXMS (Sigma), and 0.5 mm IBMX. After 48 h, preadipocyte differentiation was continued using induction maintenance medium containing DMEM/F12, 10% FBS, 5 μg/mL insulin, and 1% antibiotics. For FATP1 knockdown, cells at 80% confluence were transfected by siRNAs or si-NC using a Lipofectin 3000 transfection kit (Invitrogen, San Diego, GA, USA) according to the manufacturer’s instructions. For overexpression of FATP1, Ad-FATP1 or Ad-NC were used to infect cells at a multiplicity of infection (MOI) of 25.

2.6. Oil Red O Staining

After experimental treatment, cells were washed three times in 1 × PBS, and then fixed for 30 min with 4% paraformaldehyde. The cells were then stained using Oil red O staining solution for 30 min and washed with 1 × PBS. Finally, representative images were obtained using an Olympus IX71 microscope.

2.7. Total RNA Extraction and qRT-PCR Analysis

Total RNA was isolated using TRIzol^TM Reagent (Invitrogen, San Diego, GA, USA) according to the manufacturer’s instructions. RNA integrity and RNA concentration were analyzed by 1% agarose gel electrophoresis and UV spectrophotometry. cDNA was synthesized from total RNA using the Prime Script^TM RT Kit (Takara, Dalian, China). qRT-PCR was performed using the SYBR Green PCR Master Mix Kit (Takara, Biotech, Dalian, China) on a 7500 Real-Time PCR System (Applied Biosystems, Forster City, CA, USA) according to the manufacturer’s recommendations. qRT-PCR primer information is listed in

Table 2. The primer sequences for qRT-PCR.

Primer	Sequence (5′-3′)	Fragment Size (bp)
FATP1-F	AAGAGCCTGGTCAACTG	186
FATP1-R	TAGGAGTAGTGCCCTGC
β-actin-F	CATCAATGAGCGTCGGTTCC	147
β-actin-R	CCGTGGCGTAGCAGAGGTC
PPAR-γ-F	GAGATGAGTACACACGCCAAG	216
PPAR-γ-R	GGGCTAAAGTCCATCACCAA
LPL-F	GATGATGCGGATTTTGTAGACG	156
LPL-R	GTTGGAAAGTGCCTCCGTTAG
C/EBP-β-F	TTCCTCTCCGACCTCTTCTC	173
C/EBP-β-R	CCAGACTCACGTAGCCGTACT
SLPI-F	AGACGACCAGTGCGTAGGTA	143
SLPI-R	TCCCAAACGGCAGGAATCAG
STC1-F	AGTGATTCGCTGCCTCAACA	107
STC1-R	CTCCTGGACTTCGGCAATCA
AKR1C1-F	TCGATGGCCTCAACAGCAAT	186
AKR1C1-R	TGGGGAAGACAAGAATCAATGC
SEMA6A-F	GGGCTGCTTTCCCAGAAGAT	209
SEMA6A-R	TATGGTCCCTGGCAGCAATG
HOXA4-F	AGAAGATCCATGTCAGCGCC	194
HOXA4-R	CGGGTCAGGTAGCGGTTAAA
TNFRSF19-F	GCTAGTGAGGAGCCGACCC	174
TNFRSF19-R	TCTGTTGCCTGAGTAGCACG
SLN-F	CAGCCCAGTGTGTCCTTGAC	216
SLN-R	AGGCAAACTTCTGAGGGCAC
PTGS2-F	TTGGCTACGGGAACACAACA	159
PTGS2-R	AAGGGGATGCCAGTGGTAGA

. Target gene expression levels were analyzed by the 2^−ΔΔCt method using ACTB to normalize expression.

2.8. Total Protein Extraction and Western Blotting

Cells were lysed with RIPA (Beyotime, Haimen, China) containing protease inhibitor cocktail (Roche, Indianapolis, IN, USA). Total protein samples (20 µg per well) were resolved by a 12% SDS-PAGE gel. The resolved protein bands were then transferred to PVDF membranes. Next, the PVDF membranes were blocked with fat-free milk (5% w/v), and incubated with primary antibody overnight at 4 °C. The following primary antibodies were used: anti-FATP1 (ab 2759688 ABclonal, Woburn, MA, USA); anti-LPL (bs-2336R Bioss, Beijing, China); anti-FADS2 (bs-11516R Bioss, Beijing, China); and anti-SCD1 (ab236868 Abcam, Waltham, MA, USA). After washing three times with TBST, the membranes were incubated with secondary antibody for 2 h. Finally, the luminescence signals were detected using a ChemiDoc^TM XRS+ System (Bio-Rad, Hercules, CA, USA).

2.9. RNA Sequencing and Functional Enrichment Analysis of DEGs

Following pre-treatment with Ad-FATP1, Ad-NC, siRNA, and siNC, the preadipocytes (three replicates for each treatment) were induced to differentiate on the fourth day. In total, 12 cell samples (four treatments × three replicates) were harvested for subsequent analysis by RNA-Seq. RNA sequencing analysis was performed by Novogene. After processing of the RNA-Seq results, DEGs were identified using DESeq software. DEGs are defined as genes with |log₂ (Fold Change)| ≥ 1.5 and adjusted p ≤ 0.05. Go enrichment analysis and KEGG enrichment analysis of DEGs were implemented by cluster Profiler (3.4.4) software. GO terms with a p value ≤ 0.05 were defined as significantly enriched.

2.10. Statistical Analysis

All data analysis was performed using SPSS 19.0. The data is presented as mean ± SD. The data were analyzed using a Dunnett’s multiple comparison test and one-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01 were used to define statistical significance. All experiments were performed (at least) in triplicate.

3. Results

3.1. FATP1 Expression Patterns in Qinchuan Cattle Tissues and Differentiated Preadipocytes

To explore the expression characteristics of FATP1, we first investigated FATP1 expression levels in the tissues of newborn and adult Qinchuan cattle. FATP1 was widely expressed in all the tissues tested (at both ages). Expression of FATP1 was especially high in heart, kidney, muscle, small intestine, large intestine, and perirenal fat tissues in newborn cattle. In most of the tissues investigated, including spleen, liver, reticulum, abomasum, small intestine, large intestine, muscle, kidney, and heart, FATP1 expression decreased with age (Figure 1A). However, FATP1 expression increased with age in omasum and perirenal fat tissues (Figure 1A). Next, we investigated FATP1 expression levels every two days during adipocyte differentiation. FATP1 expression was relatively stable during differentiation until the fourth day, at which time FATP1 expression increased sharply (Figure 1B).

3.2. Overexpression of FATP1 Promotes Preadipocyte Differentiation in Qinchuan Cattle

To further explore the role of FATP1 in preadipocyte differentiation, Ad-FATP1 was constructed and used to infect preadipocytes (MOI, 25). The infected cells were then induced to differentiate until the 8th day. qRT-PCR analysis revealed that Ad-FATP1 significantly promoted the expression of FATP1 during differentiation, inducing a greater than 1100-fold increase in FATP1 mRNA expression (in comparison with NC) by the 4th day (Figure 2A). Furthermore, Oil Red O staining provided evidence that FATP1 overexpression markedly and stably promoted lipid droplet formation (Figure 2B).

Preadipocyte differentiation into mature adipocytes is also known to involve additional marker genes. To further investigate preadipocyte differentiation, the expression levels of PPARG, a marker gene of adipogenic differentiation [9], and LPL, a marker gene of lipid metabolism [10,11], were analyzed by qRT-PCR. The results reveal that overexpression of FATP1 up-regulated the expression of these two genes at the 4th day of differentiation (Figure 2C). Thus, overexpression of FATP1 increased LPL and PPARG expression levels, promoted the differentiation of preadipocytes, and promoted lipid deposition in Qinchuan cattle.

3.3. Interference of FATP1 Expression Inhibits Preadipocyte Differentiation in Qinchuan Cattle

Three FATP1 siRNAs were synthesized and transfected into preadipocytes, and the siRNA with the highest interference efficiency was selected for further FATP1 knockdown experiments. All three siRNAs dramatically decreased the expression of FATP1 (Figure S1). siRNA3 (interference efficiency, 90%) was selected for further FATP1 knockdown experiments (and is henceforth referred to as si-FATP1).

Preadipocytes were infected with si-FATP1 and the cells were then induced to differentiate. qRT-PCR analysis demonstrated that si-FATP1 significantly decreased the expression of FATP1 during adipocyte differentiation (Figure 3A). Oil red O staining revealed that knockdown of FATP1 significantly reduced the number of lipid droplets in preadipocytes (Figure 3B). The expression levels of several adipocyte differentiation marker genes were also analyzed following interference of FATP1. qRT-PCR analysis demonstrates that the expression levels of CEBPB (encoding C/EBP-β) and LPL were significantly decreased following interference of FATP1. Thus, interference of FATP1 inhibited the expression of LPL and CEBPB, suppressed adipocyte differentiation, and decreased lipid deposition in Qinchuan cattle.

3.4. Transcriptome Sequencing and Annotation of DEGs

To further explore the effects of FATP1 gene expression on preadipocyte differentiation and lipid deposition in Qinchuan cattle, preadipocyte cells were infected/transfected with Ad-FATP1, Ad-NC, siRNA, and si-NC. Two days after infection/transfection, the preadipocytes were induced to differentiate. The preadipocyte cells were then harvested on the 4th day of differentiation. Each of the four treatments (Ad-FATP1, Ad-NC, siRNA, and si-NC) was replicated three times, producing a total of 12 samples. All 12 samples were then analyzed by RNA-Seq.

Genes that were differentially expressed between treatments (Ad-FATP1, Ad-NC, siRNA, and si-NC) were identified using DESeq2. DEGs were screened using an adjusted p ≤ 0.05 and a |log₂ (Fold Change)| ≥ 1.5. In total, 1496 genes were identified as DEGs. Three DEGs were up-regulated by si-FATP1 and down-regulated by Ad-FATP1 (PSAT1, TNFSF18, and ENSBTAG00000040427). In addition, twenty-five DEGs were up-regulated by Ad-FATP1 and down-regulated by si-FATP1 (Figure 4). Of these 28 DEGs, the functions of 14 genes were related to adipogenic differentiation and lipid deposition. To illustrate the expression patterns of DEGs in the different treatments, heatmaps were generated for individual samples (Figure 5A) and for groups of samples (Figure 5B). A comparison of Figure 5A,B reveals that the expression levels of the most dysregulated genes were consistent across all three replicates. These results also demonstrate that overexpression of FATP1 has a greater influence on DEGs (compared with FATP1 silencing).

To further explore the functions of DEGs, GO function enrichment analysis and KEGG pathway analysis were conducted. In the FATP1 overexpression group, DEGs were associated with various GO terms, including unsaturated fatty acid metabolic process, dense core granule, receptor regulator activity (Figure 6A), and with the PPAR signaling pathway (Figure 7A and Figure 8A). In the FATP1 silencing group, DEGs were associated with several different GO Terms, including carbohydrate metabolic process, extracellular structure organization, monosaccharide binding (Figure 6B), and with several pathways, including the AMPK signaling pathway and the Insulin signaling pathway (Figure 7B and Figure 8B,C).

3.5. Validation and Dynamic Expression of DEGs in the Adipocytes of Qinchuan Cattle

To validate the RNA-seq and functional analysis results for DEGs, several DEGs associated with adipocyte differentiation and fat deposition were selected for further analysis. The expression levels of these genes in adipocytes treated with Ad-FATP1, Ad-NC, siRNA, and siNC were analyzed by qRT-PCR using ACTB as an internal reference gene. qRT-PCR analysis revealed that the expression levels of SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD were significant up-regulated by overexpression of FATP1 (Figure 9). In contrast, the expression levels of SLPI, STC1, SEMA6A, TNFRSF19, SLN, HOXA4, ADCYP1, FADS2, SCD, and CREM were significantly down-regulated by silencing of FATP1 (Figure 10). Together, these qRT-PCR results agree with and validate the results of our RNA-seq analysis.

In addition, the protein expression levels of four key DEGs were investigated by western analysis following FATP1 overexpression and FATP1 interference in adipocytes. While FATP1 overexpression promoted FADS2, LPL, and SCD protein levels, FATP1 interference reduced FADS2, LPL, and SCD protein levels (Figure 11). These results are consistent with our analyses of mRNA expression levels by RNA-seq and qRT-PCR. To further understanding of the effects of FATP1 expression levels on these proteins, we analyzed their dynamic expression during differentiation following infection,/transfection with Ad-FATP1 or si-FATP1. While overexpression of FATP1 promoted the expression of LPL, FADS2, and SCD during differentiation, silencing of FATP1 inhibited their expression (Figure 12).

4. Discussion

In the present study, our analyses of FATP1 expression patterns demonstrate that FATP1 was highly expressed in heart, kidney, muscle, and adipose tissues. These results are consistent with previous reports from human and mouse studies indicating that FATP1 is highly expressed in tissues exhibiting rapid fatty acid metabolism, including muscle, heart, and adipose tissue [3,4]. Our results also reveal that FATP1 was highly expressed in the perirenal fat tissue of adult and infant Qinchuan cattle. Moreover, FATP1 expression levels were demonstrated to increase during adipocyte differentiation (especially in the early stages of differentiation). The observed expression patterns of FATP1 in fat tissue and during adipocytic differentiation indicate that FATP1 may play a crucial role in fat formation in Qinchuan cattle.

To further elucidate the function of FATP1 during adipogenesis in Qinchuan cattle, overexpression and interference assays were employed. Although FATP1 gain,/loss of function could be demonstrated following FATP1 overexpression,/interference, FATP1 was observed to play a role in adipocyte differentiation under both assay conditions. FATP1 overexpression was demonstrated to increase deposition of lipid droplets and to up-regulate the expression of lipid metabolism-related genes, including LPL and PPARG. In contrast, FATP1 interference was demonstrated to decrease deposition of lipid droplets and to down-regulate expression of lipid metabolism-related genes. Together, these results provide evidence that the FATP1 gene plays a regulatory role in adipogenic differentiation and lipid deposition in Qinchuan cattle. This conclusion is consistent with previous research on porcine intramuscular preadipocytes and chicken preadipocytes [10,11].

To unravel the role of FATP1 in adipocyte differentiation, RNA-Seq analysis was conducted on FATP1 overexpression,/interference cell models. Using a |log₂ (Fold Change)| ≥ 1.5 and a p ≤ 0.05 as screening conditions, DEGs in the overexpression and interference groups were identified. These DEGs were then sorted into an up-regulated gene set and a down-regulated gene set. In addition, we identified the gene set up-regulated by Ad-FATP1 and down-regulated by si-FATP1, and the gene set up-regulated by si-FATP1 and down-regulated by Ad-FATP1. In total, 28 genes in these two gene sets were identified. Finally, we identified all the genes within these two gene sets whose functions are related to adipogenic differentiation and fat deposition. These were observed to include SLPI, STC1, EMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, SCD, HOXA4, and CREM.

SLPI (secretory leukocyte protease inhibitor) is known to suppress proinflammatory responses through inhibition of NF-κB signaling, and also to demonstrate immuno-modulatory activities on inflammatory diseases [14]. In addition, SLPI has been demonstrated to play a role in obesity, with one study reporting that SLPI constrained obesity by increasing browning—SLPI levels were positively correlated with browning and negatively correlated with obesity [15].

Tumor necrosis factor receptor superfamily (TNFRSF) members are glycoproteins with a single transmembrane region, a cysteine-rich extracellular ligand binding domain, and a diverse cytoplasmic tail. TNFRSF19 is up-regulated by the Wnt signaling pathway and down-regulated by C/EBP. TNFRSF19 is known to inhibit adipogenic differentiation and thus function as a negative regulator of adipocyte differentiation. TNFRSF19 overexpression,/knockdown was also observed to significantly decrease,/increase adipogenesis [16].

ADCYAP1 is known to play roles in glucose and energy homeostasis [17], and in the regulation of lipid metabolism [18]. In an ADCYAP1 knockout mouse model, white adipose tissue (e.g., epididymal, retroperitoneal, and abdominal subcutaneous adipose tissues) was significantly reduced in size and mass. In addition, the expression levels of AP2 (encoding the fatty acid binding protein aP2), an important marker gene for adipocyte differentiation, were decreased after ADCYAP1 knockout. The results obtained with the ADCYAP1 knockout mouse model demonstrate the important role played by ADCYAP1 in lipid metabolism and regulation of body weight [19].

Fatty acid desaturase 2 (FADS2) is a member of the fatty acid desaturase protein family. FADS2 catalyzes the desaturation reaction during long chain (≥C20) polyunsaturated fatty acid (LC-PUFA) synthesis, and is pivotal in LC-PUFA biosynthesis and maintaining LC-PUFA homeostasis [20]. Genetic studies have revealed that a polymorphism in the FADS2 gene affects the fatty acid composition of bovine milk by modifying mir-744 binding [21,22]. In addition, PUFAs were found to have a direct effect on FADS2 expression in differentiated 3T3-L1 adipocytes [23]. Research on the mechanism of action of FADS2 in human and mouse found that FADS2 was the target of mTOR and SREBP signaling. While activation of the mTORC1 signaling pathway increased FADS2 expression, inhibition reduced FADS2 expression. Likewise, overexpression of SREBP-1/2 increased FADS2 expression [24]. SREBP-1 and PPARα were both demonstrated to up-regulate FADS2 promoter activity in a Luciferase reporter assay [25].

Stearoyl-CoA Desaturase 1 (SCD1) is a key regulator of de novo lipogenesis, acting as a rate-limiting enzyme. SCD1 catalyzes the synthesis of MUFAs. Loss of SCD1 potentiates beige adipocyte formation in mice and SCD1 deficiency can induce adipose-derived mesenchymal stem cells to differentiate into beige adipocytes [26]. Overexpression of SCD1 in the subcutaneous adipose tissues of mouse revealed that SCD1 can upregulate lipases and induce lipolysis, further promoting energy expenditure and fat mobilization. Furthermore, SCD1 knockdown inhibited lipolysis in adipocytes by down-regulating lipases and reducing lipophagy. BMP4 was also demonstrated to be a crucial factor regulating SCD1 expression, up-regulating SCD1 expression through the Smad pathway [27].

Lipoprotein lipase (LPL) is a multifunctional enzyme that plays a pivotal role in lipid transport and metabolism [28], especially in the hydrolysis of triglycerides [29]. LPL expression is known to be regulated in a tissue-specific manner. Moreover, nutrient levels and hormonal states also have a profound effect on LPL expression. LPL is also an important marker gene for adipocyte differentiation, and LPL expression levels increase with triglyceride accumulation during preadipocyte differentiation [30]. In addition, LPL is essential for fatty acid storage and uptake during 3T3-L1 preadipocyte differentiation [31]. When LPL expression is inhibited, the absorption of exogenous lipids is hindered, thus affecting the deposition of fat [32].

Taken together, the research described above provides evidence that the aforementioned genes are involved in fat deposition and fatty acid metabolism directly or indirectly. In the present study, we used qRT-PCR to validate the effects of FATP1 on the expression of these genes through FATP1 overexpression and FATP1 silencing. These results are also consistent with our RNA-seq results, providing further support for the view that FATP1 influences the expression of key genes and regulates adipocyte differentiation and fatty acid metabolism. Additional research is required to explore the mechanism of action by which FATP1 regulates these adipogenic genes.

5. Conclusions

In summary, we demonstrate that FATP1 is extensively expressed in the tissues and differentiating adipocytes of Qinchuan cattle. While FATP1 overexpression promoted preadipocyte differentiation in Qinchuan cattle, FATP1 interference demonstrated the opposite effect. Through RNA-seq analysis of adipocytes in which FATP1 was overexpressed,/silenced, we were able to identify DEGs related to fat metabolism. The genes in this set included SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD. Functional annotation revealed that these DEGs were enriched in the PPAR signaling pathway, AMPK signal pathway, and Insulin signaling pathway. These findings provide evidence that FATP1 is a candidate gene for the regulation of fat deposition and fatty acid metabolism in cattle and might devote to beef cattle breeding.